Orthologous regulated operons containing susC_Nan-1 gene

Properties
Regulog:	NanR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Phylum:	Bacteroidetes

Built upon 59 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides eggerthii DSM 20697
Position: -85 Score: 5.98357 Sequence: TTAATAAAATAATTTATTAAATA Locus tag: BACEGG_02293 Name: nanT-II Funciton: Predicted N-acetyl-neuraminate transporter, MFS family Locus tag: BACEGG_02294 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: BACEGG_02295 Name: nanE-II Funciton: N-acetylmannosamine 2-epimerase Locus tag: BACEGG_02296 Name: susC_Nan-1 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BACEGG_02297 Name: susD_Nan-1 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers Locus tag: BACEGG_02298 Name: GH43 Funciton: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
nanT-II-nanA-nanE-II-susC_Nan-1-susD_Nan-1-GH43	-85	6	TTAATAAAATAATTTATTAAATA	BACEGG_02293
Bacteroides vulgatus ATCC 8482
Position: -38 Score: 5.0034 Sequence: AAGTTCATTTAATTTTTTAATTA Position: -18 Score: 5.09965 Sequence: TTAATAAATTACTAATTTATGAA Position: -5 Score: 4.97964 Sequence: TAATTATGAAAGTATTTTATTAT Locus tag: BVU_2029 Name: susC_Nan-1 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BVU_2030 Name: susD_Nan-1 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers Locus tag: BVU_2031 Name: GH43 Funciton: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
susC_Nan-1-susD_Nan-1-GH43	-38	5	AAGTTCATTTAATTTTTTAATTA	BVU_2029
	-18	5.1	TTAATAAATTACTAATTTATGAA
	-5	5	TAATTATGAAAGTATTTTATTAT