Orthologous regulated operons containing exbD2 gene

Properties
Regulog:	NanR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Phylum:	Bacteroidetes

Built upon 59 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides cellulosilyticus DSM 14838
Position: -44 Score: 5.68674 Sequence: ATAATAAACAAATTAATTAATTA Locus tag: BACCELL_01010 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACCELL_01011 Name: null Funciton: hypothetical protein Locus tag: BACCELL_01012 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACCELL_01013 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
exbB-BACCELL_01011-exbD-exbD2	-44	5.7	ATAATAAACAAATTAATTAATTA	BACCELL_01010
Bacteroides coprophilus DSM 18228
Position: -43 Score: 5.02072 Sequence: TTTATAAACTATTAATTAATTAA Locus tag: BACCOPRO_02433 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACCOPRO_02432 Name: null Funciton: hypothetical protein Locus tag: BACCOPRO_02431 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACCOPRO_02430 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
exbB-BACCOPRO_02432-exbD-exbD2	-43	5	TTTATAAACTATTAATTAATTAA	BACCOPRO_02433
Bacteroides eggerthii DSM 20697
Position: -44 Score: 5.4656 Sequence: ATAATAAGTAATTTAATTAATTA Locus tag: BACEGG_00309 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACEGG_00310 Name: null Funciton: hypothetical protein Locus tag: BACEGG_00311 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACEGG_00312 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
exbB-BACEGG_00310-exbD-exbD2	-44	5.5	ATAATAAGTAATTTAATTAATTA	BACEGG_00309
Bacteroides fragilis NCTC 9343
Position: -43 Score: 5.46923 Sequence: ATAATAATAATTTAATTAATTAA Locus tag: BF3530 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BF3529 Name: null Funciton: hypothetical protein Locus tag: BF3528 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BF3527 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
exbB-BF3529-exbD-exbD2	-43	5.5	ATAATAATAATTTAATTAATTAA	BF3530
Bacteroides ovatus ATCC 8483
Position: -39 Score: 4.81098 Sequence: ATAATAATCAATTAATTAATCTT Locus tag: BACOVA_00648 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACOVA_00649 Name: null Funciton: hypothetical protein Locus tag: BACOVA_00650 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACOVA_00651 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
exbB-BACOVA_00649-exbD-exbD2	-39	4.8	ATAATAATCAATTAATTAATCTT	BACOVA_00648
Bacteroides stercoris ATCC 43183
Position: -44 Score: 5.4656 Sequence: ATAATAAGTAATTTAATTAATTA Locus tag: BACSTE_03148 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACSTE_03147 Name: null Funciton: hypothetical protein Locus tag: BACSTE_03146 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACSTE_03145 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
exbB-BACSTE_03147-exbD-exbD2	-44	5.5	ATAATAAGTAATTTAATTAATTA	BACSTE_03148
Bacteroides thetaiotaomicron VPI-5482
Position: -39 Score: 4.81098 Sequence: ATAATAATCAATTAATTAATCTT Locus tag: BT2055 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BT2054 Name: null Funciton: hypothetical protein Locus tag: BT2053 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BT2052 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
exbB-BT2054-exbD-exbD2	-39	4.8	ATAATAATCAATTAATTAATCTT	BT2055
Bacteroides uniformis ATCC 8492
Position: -44 Score: 5.91523 Sequence: ATAATAAATAAATTAATTAATTA Locus tag: BACUNI_01658 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACUNI_01657 Name: null Funciton: hypothetical protein Locus tag: BACUNI_01656 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACUNI_01655 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
exbB-BACUNI_01657-exbD-exbD2	-44	5.9	ATAATAAATAAATTAATTAATTA	BACUNI_01658

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing exbD2 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --