Orthologous regulated operons containing BT4083 gene
| Regulog: | Crp - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | |
| Effector: | |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides thetaiotaomicron VPI-5482 | ||||
|
Position: -168
Score: 5.69902 Sequence: TTATATGTTATAGAATATAAAA
Locus tag: BT4080
Name: sbp_Crp-1 Funciton: Six-beta-propeller protein, cell surface exposed, putatively involved in polysaccharides binding
Locus tag: BT4081
Name: susC_Crp-1 Funciton: TonB-dependent outer membrane transporter of oligosaccharides
Locus tag: BT4082
Name: susD_Crp-1 Funciton: Outer membrane polysaccharide binding protein for oligosaccharides
Locus tag: BT4083
Name: null Funciton: hypothetical protein
Locus tag: BT4084
Name: BT4084 Funciton: Glycosyl hydrolase family 43, five-bladed beta-propellor domain |
||||
| sbp_Crp-1-susC_Crp-1-susD_Crp-1-BT4083-BT4084 | -168 | 5.7 | TTATATGTTATAGAATATAAAA | BT4080 |