Orthologous regulated operons containing secDF gene

Properties
Regulog:	Crp - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:
Effector:
Phylum:	Bacteroidetes

Built upon 113 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides cellulosilyticus DSM 14838
Position: -196 Score: 5.03588 Sequence: TAATATGTTACACAAAAGATAT Position: -62 Score: 5.79697 Sequence: TTTTCTGTTATAGAACAGAATT Locus tag: BACCELL_02471 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACCELL_02470 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACCELL_02469 Name: PF03372 Funciton: Endonuclease/exonuclease/phosphatase Locus tag: BACCELL_02468 Name: PF01432 Funciton: Peptidase M3A/M3B, thimet/oligopeptidase F Locus tag: BACCELL_02467 Name: secDF Funciton: Preprotein translocase subunits SecD-SecF
PF01694-PF01694-PF03372-PF01432-secDF	-196	5	TAATATGTTACACAAAAGATAT	BACCELL_02471
	-62	5.8	TTTTCTGTTATAGAACAGAATT
Bacteroides dorei DSM 17855
Position: -71 Score: 6.17781 Sequence: TTTTCTGTTATATAACAGAATA Locus tag: BACDOR_01705 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACDOR_01704 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACDOR_01703 Name: PF03372 Funciton: Endonuclease/exonuclease/phosphatase Locus tag: BACDOR_01702 Name: PF01432 Funciton: Peptidase M3A/M3B, thimet/oligopeptidase F Locus tag: BACDOR_01701 Name: secDF Funciton: Preprotein translocase subunits SecD-SecF
PF01694-PF01694-PF03372-PF01432-secDF	-71	6.2	TTTTCTGTTATATAACAGAATA	BACDOR_01705
Bacteroides eggerthii DSM 20697
Position: -188 Score: 5.34989 Sequence: TAATATGTTACACAAAAGAAAA Position: -61 Score: 5.79697 Sequence: TTTTCTGTTATAGAACAGAATT Locus tag: BACEGG_03101 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACEGG_03102 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACEGG_03103 Name: PF03372 Funciton: Endonuclease/exonuclease/phosphatase Locus tag: BACEGG_03104 Name: PF01432 Funciton: Peptidase M3A/M3B, thimet/oligopeptidase F Locus tag: BACEGG_03105 Name: secDF Funciton: Preprotein translocase subunits SecD-SecF
PF01694-PF01694-PF03372-PF01432-secDF	-188	5.3	TAATATGTTACACAAAAGAAAA	BACEGG_03101
	-61	5.8	TTTTCTGTTATAGAACAGAATT
Bacteroides ovatus ATCC 8483
Position: -195 Score: 5.03588 Sequence: ATATATGTTACACAAAAGATTA Position: -66 Score: 5.41387 Sequence: TTTCATGCTTTAAAACAGAATT Locus tag: BACOVA_02079 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACOVA_02080 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACOVA_02081 Name: PF03372 Funciton: Endonuclease/exonuclease/phosphatase Locus tag: BACOVA_02082 Name: PF01432 Funciton: Peptidase M3A/M3B, thimet/oligopeptidase F Locus tag: BACOVA_02083 Name: secDF Funciton: Preprotein translocase subunits SecD-SecF
PF01694-PF01694-PF03372-PF01432-secDF	-195	5	ATATATGTTACACAAAAGATTA	BACOVA_02079
	-66	5.4	TTTCATGCTTTAAAACAGAATT
Bacteroides stercoris ATCC 43183
Position: -188 Score: 4.34752 Sequence: TTAATTGTTACACAAAAGAAAA Position: -61 Score: 5.79697 Sequence: TTTTCTGTTATAGAACAGAATT Locus tag: BACSTE_02140 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACSTE_02141 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACSTE_02142 Name: PF03372 Funciton: Endonuclease/exonuclease/phosphatase Locus tag: BACSTE_02143 Name: PF01432 Funciton: Peptidase M3A/M3B, thimet/oligopeptidase F Locus tag: BACSTE_02144 Name: secDF Funciton: Preprotein translocase subunits SecD-SecF
PF01694-PF01694-PF03372-PF01432-secDF	-188	4.3	TTAATTGTTACACAAAAGAAAA	BACSTE_02140
	-61	5.8	TTTTCTGTTATAGAACAGAATT
Bacteroides thetaiotaomicron VPI-5482
Position: -192 Score: 4.87887 Sequence: ATATATGTTACACAAAAGATTT Position: -69 Score: 4.98217 Sequence: TTCCATGCTTTAAAACAGAATT Locus tag: BT2831 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BT2832 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BT2833 Name: PF03372 Funciton: Endonuclease/exonuclease/phosphatase Locus tag: BT2834 Name: PF01432 Funciton: Peptidase M3A/M3B, thimet/oligopeptidase F Locus tag: BT2835 Name: secDF Funciton: Preprotein translocase subunits SecD-SecF
PF01694-PF01694-PF03372-PF01432-secDF	-192	4.9	ATATATGTTACACAAAAGATTT	BT2831
	-69	5	TTCCATGCTTTAAAACAGAATT
Bacteroides uniformis ATCC 8492
Position: -230 Score: 5.03588 Sequence: TAATATGTTACACAAAAGATAT Position: -97 Score: 5.79697 Sequence: TTTTCTGTTATAGAACAGAATT Locus tag: BACUNI_03999 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACUNI_04000 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BACUNI_04001 Name: PF03372 Funciton: Endonuclease/exonuclease/phosphatase Locus tag: BACUNI_04002 Name: PF01432 Funciton: Peptidase M3A/M3B, thimet/oligopeptidase F Locus tag: BACUNI_04003 Name: secDF Funciton: Preprotein translocase subunits SecD-SecF
PF01694-PF01694-PF03372-PF01432-secDF	-230	5	TAATATGTTACACAAAAGATAT	BACUNI_03999
	-97	5.8	TTTTCTGTTATAGAACAGAATT
Bacteroides vulgatus ATCC 8482
Position: -71 Score: 6.17781 Sequence: TTTTCTGTTATATAACAGAATA Locus tag: BVU_0995 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BVU_0994 Name: PF01694 Funciton: Peptidase S54, rhomboid domain Locus tag: BVU_0993 Name: PF03372 Funciton: Endonuclease/exonuclease/phosphatase Locus tag: BVU_0992 Name: PF01432 Funciton: Peptidase M3A/M3B, thimet/oligopeptidase F Locus tag: BVU_0991 Name: secDF Funciton: Preprotein translocase subunits SecD-SecF
PF01694-PF01694-PF03372-PF01432-secDF	-71	6.2	TTTTCTGTTATATAACAGAATA	BVU_0995

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing secDF gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --