Orthologous regulated operons containing celD gene

Properties
Regulog:	CelR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes

Built upon 1 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Position: -83 Score: 6.83644 Sequence: TTTCCGCAAGTATGAGGAAA Locus tag: LEUM_0927 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: LEUM_0928 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: LEUM_0929 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: LEUM_0930 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: LEUM_0931 Name: LEUM_0931 Funciton: Conserved hypothetical protein Locus tag: LEUM_0932 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
bglA-celB-celR-celA-LEUM_0931-celD	-83	6.8	TTTCCGCAAGTATGAGGAAA	LEUM_0927

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --