Orthologous regulated operons containing LEUM_0931 gene
| Regulog: | CelR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | BglG |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||||
|
Position: -83
Score: 6.83644 Sequence: TTTCCGCAAGTATGAGGAAA
Locus tag: LEUM_0927
Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: LEUM_0928
Name: celB Funciton: Cellobiose-specific PTS, component EIIB
Locus tag: LEUM_0929
Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family
Locus tag: LEUM_0930
Name: celA Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: LEUM_0931
Name: LEUM_0931 Funciton: Conserved hypothetical protein
Locus tag: LEUM_0932
Name: celD Funciton: Cellobiose-specific PTS, component EIIC |
||||
| bglA-celB-celR-celA-LEUM_0931-celD | -83 | 6.8 | TTTCCGCAAGTATGAGGAAA | LEUM_0927 |