Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing celB2 gene

Properties
Regulog: CelR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum: Firmicutes
Built upon 15 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -97
Score: 5.31342
Sequence: CTTCACAATCGATACGGAAA
Locus tag: Sez_1282
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family
Locus tag: Sez_1281
Name: celB2
Funciton: Cellobiose-specific PTS, component EIIB
Locus tag: Sez_1280
Name: celA2
Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: Sez_1279
Name: PF11687
Funciton: Hypothetical membrane protein, PF11687 family
Locus tag: Sez_1278
Name: celD2
Funciton: Cellobiose-specific PTS, component EIIC
celR-celB2-celA2-PF11687-celD2 -97 5.3 CTTCACAATCGATACGGAAA Sez_1282
Streptococcus pyogenes M1 GAS
Position: -100
Score: 5.51993
Sequence: TTTCACAATCAATGCGGAAA
Locus tag: SPy1325
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family
Locus tag: SPy1324
Name: celB2
Funciton: Cellobiose-specific PTS, component EIIB
Locus tag: SPy1323
Name: celA2
Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: SPy1322
Name: PF11687
Funciton: Hypothetical membrane protein, PF11687 family
celR-celB2-celA2-PF11687 -100 5.5 TTTCACAATCAATGCGGAAA SPy1325
Streptococcus suis 05ZYH33
Position: -100
Score: 5.69953
Sequence: TTTCATTAATGATGCGGAAA
Locus tag: SSU05_2076
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family
Locus tag: SSU05_2075
Name: celB2
Funciton: Cellobiose-specific PTS, component EIIB
Locus tag: SSU05_2074
Name: celA2
Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: SSU05_2073
Name: celA2
Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: SSU05_2072
Name: PF11687
Funciton: Hypothetical membrane protein, PF11687 family
Locus tag: SSU05_2071
Name: celD2
Funciton: Cellobiose-specific PTS, component EIIC
celR-celB2-celA2-celA2-PF11687-celD2 -100 5.7 TTTCATTAATGATGCGGAAA SSU05_2076