Orthologous regulated operons containing celA gene

Properties
Regulog:	CelR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes

Built upon 15 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -83 Score: 5.53688 Sequence: TTGCCGTAGTGCTAAGGAAA Locus tag: SDEG_1401 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SDEG_1400 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SDEG_1399 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SDEG_1398 Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family Locus tag: SDEG_1397 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
celB-celR-celA-PF06570-celD	-83	5.5	TTGCCGTAGTGCTAAGGAAA	SDEG_1401
Streptococcus gallolyticus UCN34
Position: -93 Score: 5.92582 Sequence: TTTCCTTATCAAAGAGGAAA Locus tag: GALLO_1213 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: GALLO_1212 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: GALLO_1211 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: GALLO_1210 Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family Locus tag: GALLO_1209 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
celB-celR-celA-PF06570-celD	-93	5.9	TTTCCTTATCAAAGAGGAAA	GALLO_1213
Streptococcus gordonii str. Challis substr. CH1
Position: -96 Score: 6.27651 Sequence: TTTCCGTTTCGATACGGAAA Locus tag: SGO_1580 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SGO_1579 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SGO_1578 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SGO_1577 Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family Locus tag: SGO_1576 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
celB-celR-celA-PF06570-celD	-96	6.3	TTTCCGTTTCGATACGGAAA	SGO_1580
Streptococcus mutans UA159
Position: -92 Score: 5.29245 Sequence: TTCCGTTTTCAATACGGAAA Locus tag: SMU.1600 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SMU.1599 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SMU.1598 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SMU.1597c Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family Locus tag: SMU.1596 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
celB-celR-celA-PF06570-celD	-92	5.3	TTCCGTTTTCAATACGGAAA	SMU.1600
Streptococcus pneumoniae TIGR4
Position: -125 Score: 5.68403 Sequence: TTTCCATATCATTTAGGAAA Locus tag: SP_0305 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SP_0306 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SP_0307 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SP_0308 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SP_0309 Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family Locus tag: SP_0310 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
celB-celR-celR-celA-PF06570-celD	-125	5.7	TTTCCATATCATTTAGGAAA	SP_0305
Streptococcus uberis 0140J
Position: -141 Score: 4.8253 Sequence: TTGCTTTTTTAATAGGGAAA Position: -100 Score: 6.04989 Sequence: TTTCCGCATCATTACGGAAA Locus tag: SUB0529 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SUB0530 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SUB0531 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SUB0532 Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family Locus tag: SUB0533 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
celB-celR-celA-PF06570-celD	-141	4.8	TTGCTTTTTTAATAGGGAAA	SUB0529
	-100	6	TTTCCGCATCATTACGGAAA