Orthologous regulated operons containing celF gene

Properties
Regulog:	CelR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes

Built upon 15 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptococcus suis 05ZYH33
Position: -270 Score: 6.00986 Sequence: TTTCCGTTGTGATACGGAAA Locus tag: SSU05_2079 Name: celF Funciton: Alpha-galactosidase/6-phospho-beta- glucosidase Locus tag: SSU05_2078 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: SSU05_2077 Name: celO Funciton: Predicted outer surface protein
celF-bglA-celO	-270	6	TTTCCGTTGTGATACGGAAA	SSU05_2079

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --