Orthologous regulated operons containing celF gene
| Regulog: | CelR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | BglG |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptococcus suis 05ZYH33 | ||||
|
Position: -270
Score: 6.00986 Sequence: TTTCCGTTGTGATACGGAAA
Locus tag: SSU05_2079
Name: celF Funciton: Alpha-galactosidase/6-phospho-beta- glucosidase
Locus tag: SSU05_2078
Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: SSU05_2077
Name: celO Funciton: Predicted outer surface protein |
||||
| celF-bglA-celO | -270 | 6 | TTTCCGTTGTGATACGGAAA | SSU05_2079 |