Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing LACR_0765 gene

Properties
Regulog: LACR_0766 - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Firmicutes
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -35
Score: 6.31715
Sequence: AGAGTTTAACGTTAAACTAA
Locus tag: LACR_0761
Name: LACR_0761
Funciton: Predicted polysaccharide ABC transporter, permease protein 1
Locus tag: LACR_0762
Name: LACR_0762
Funciton: Predicted polysaccharide ABC transporter, permease protein 2
Locus tag: LACR_0763
Name: LACR_0763
Funciton: Predicted polysaccharide ABC transporter, substrate-binding protein
Locus tag: LACR_0764
Name: LACR_0764
Funciton: Predicted integral membrane protein
Locus tag: LACR_0765
Name: LACR_0765
Funciton: Predicted maltodextrin glucosidase (EC 3.2.1.20)
Locus tag: LACR_0766
Name: LACR_0766
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
LACR_0761-LACR_0762-LACR_0763-LACR_0764-LACR_0765-LACR_0766 -35 6.3 AGAGTTTAACGTTAAACTAA LACR_0761
© 2009-2020 RegPrecise