Orthologous regulated operons containing LACR_0762 gene
Regulog: | LACR_0766 - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Lactococcus lactis subsp. cremoris SK11 | ||||
Position: -35
Score: 6.31715 Sequence: AGAGTTTAACGTTAAACTAA
Locus tag: LACR_0761
Name: LACR_0761 Funciton: Predicted polysaccharide ABC transporter, permease protein 1
Locus tag: LACR_0762
Name: LACR_0762 Funciton: Predicted polysaccharide ABC transporter, permease protein 2
Locus tag: LACR_0763
Name: LACR_0763 Funciton: Predicted polysaccharide ABC transporter, substrate-binding protein
Locus tag: LACR_0764
Name: LACR_0764 Funciton: Predicted integral membrane protein
Locus tag: LACR_0765
Name: LACR_0765 Funciton: Predicted maltodextrin glucosidase (EC 3.2.1.20)
Locus tag: LACR_0766
Name: LACR_0766 Funciton: Predicted sugar utilization transcriptional regulator, LacI family |
||||
LACR_0761-LACR_0762-LACR_0763-LACR_0764-LACR_0765-LACR_0766 | -35 | 6.3 | AGAGTTTAACGTTAAACTAA | LACR_0761 |
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||||
Position: -121
Score: 6.25168 Sequence: TCGGTTTAACGATAAACTAA
Locus tag: SDEG_1903
Name: LACR_0761 Funciton: Predicted polysaccharide ABC transporter, permease protein 1
Locus tag: SDEG_1902
Name: LACR_0762 Funciton: Predicted polysaccharide ABC transporter, permease protein 2
Locus tag: SDEG_1901
Name: LACR_0764 Funciton: Predicted integral membrane protein
Locus tag: SDEG_1900
Name: LACR_0763 Funciton: Predicted polysaccharide ABC transporter, substrate-binding protein |
||||
LACR_0761-LACR_0762-LACR_0764-LACR_0763 | -121 | 6.3 | TCGGTTTAACGATAAACTAA | SDEG_1903 |