Orthologous regulated operons containing CKO_02792 gene

Properties
Regulog:	IdnR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	activator (repressor)
Biological process:	Idonate utilization
Effector:	L-idonate; 5-dehydro-D-gluconate
Phylum:	Proteobacteria/Gamma

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -39 Score: 5.29997 Sequence: TACAGTTACGCGTAACAGCT Locus tag: CKO_02793 Name: idnO Funciton: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) Locus tag: CKO_02792 Name: null Funciton: 2-ketogluconate transporter Locus tag: CKO_02791 Name: idnR Funciton: Positive regulator of L-idonate catabolism
idnO-CKO_02792-idnR	-39	5.3	TACAGTTACGCGTAACAGCT	CKO_02793

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --