Orthologous regulated operons containing idnT gene
| Regulog: | IdnR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | activator (repressor) |
| Biological process: | Idonate utilization |
| Effector: | L-idonate; 5-dehydro-D-gluconate |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -117
Score: 5.87062 Sequence: TCACGTTATGCGTAACATAG
Locus tag: b4267
Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
Locus tag: b4266
Name: idnO Funciton: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
Locus tag: b4265
Name: idnT Funciton: L-idonate, D-gluconate, 5-keto-D-gluconate transporter
Locus tag: b4264
Name: idnR Funciton: Positive regulator of L-idonate catabolism |
||||
| idnD-idnO-idnT-idnR | -117 | 5.9 | TCACGTTATGCGTAACATAG | b4267 |
| Salmonella typhimurium LT2 | ||||
|
Position: -117
Score: 5.93303 Sequence: TCACGTTATGCGTAACATTG
Locus tag: STM4484
Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
Locus tag: STM4483
Name: idnO Funciton: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
Locus tag: STM4482
Name: idnT Funciton: L-idonate, D-gluconate, 5-keto-D-gluconate transporter
Locus tag: STM4481
Name: idnR Funciton: Positive regulator of L-idonate catabolism |
||||
| idnD-idnO-idnT-idnR | -117 | 5.9 | TCACGTTATGCGTAACATTG | STM4484 |