Orthologous regulated operons containing idnD gene

Properties
Regulog:	IdnR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	activator (repressor)
Biological process:	Idonate utilization
Effector:	L-idonate; 5-dehydro-D-gluconate
Phylum:	Proteobacteria/Gamma

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -117 Score: 5.87062 Sequence: TCACGTTATGCGTAACATAG Locus tag: b4267 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264) Locus tag: b4266 Name: idnO Funciton: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) Locus tag: b4265 Name: idnT Funciton: L-idonate, D-gluconate, 5-keto-D-gluconate transporter Locus tag: b4264 Name: idnR Funciton: Positive regulator of L-idonate catabolism
idnD-idnO-idnT-idnR	-117	5.9	TCACGTTATGCGTAACATAG	b4267
Salmonella typhimurium LT2
Position: -117 Score: 5.93303 Sequence: TCACGTTATGCGTAACATTG Locus tag: STM4484 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264) Locus tag: STM4483 Name: idnO Funciton: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) Locus tag: STM4482 Name: idnT Funciton: L-idonate, D-gluconate, 5-keto-D-gluconate transporter Locus tag: STM4481 Name: idnR Funciton: Positive regulator of L-idonate catabolism
idnD-idnO-idnT-idnR	-117	5.9	TCACGTTATGCGTAACATTG	STM4484
Serratia proteamaculans 568
Position: -121 Score: 5.08153 Sequence: TCACGTTAAAGGTAACAGCT Locus tag: Spro_3288 Name: idnO Funciton: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) Locus tag: Spro_3287 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
idnO-idnD	-121	5.1	TCACGTTAAAGGTAACAGCT	Spro_3288

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --