Orthologous regulated operons containing LJ1265 gene
| Regulog: | LJ1265 - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Pentose utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactobacillus acidophilus NCFM | ||||
|
Position: -103
Score: 6.4036 Sequence: ACTTGTAATTGCTTACAAAA
Locus tag: LBA1488
Name: LJ1265 Funciton: Predicted pentose utilization transcriptional regulator, LacI family |
||||
| LJ1265 | -103 | 6.4 | ACTTGTAATTGCTTACAAAA | LBA1488 |
| Lactobacillus johnsonii NCC 533 | ||||
|
Position: -108
Score: 6.58196 Sequence: TCTTGTAAATGCTTACAAAA
Locus tag: LJ1265
Name: LJ1265 Funciton: Predicted pentose utilization transcriptional regulator, LacI family
Locus tag: LJ1264
Name: LJ1264 Funciton: Predicted pentose isomerase, TM0951
Locus tag: LJ1263
Name: LJ1263 Funciton: Conserved hypothetical protein |
||||
| LJ1265-LJ1264-LJ1263 | -108 | 6.6 | TCTTGTAAATGCTTACAAAA | LJ1265 |