Orthologous regulated operons containing LJ1266 gene
Regulog: | LJ1265 - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Pentose utilization |
Effector: | |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Lactobacillus acidophilus NCFM | ||||
Position: -46
Score: 6.4036 Sequence: TTTTGTAAGCAATTACAAGT
Locus tag: LBA1489
Name: LJ1266 Funciton: Transketolase, N-terminal section (EC 2.2.1.1)
Locus tag: LBA1490
Name: LJ1267 Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
Locus tag: LBA1492
Name: LJ1268 Funciton: Predicted pentose kinase |
||||
LJ1266-LJ1267-LJ1268 | -46 | 6.4 | TTTTGTAAGCAATTACAAGT | LBA1489 |
Lactobacillus johnsonii NCC 533 | ||||
Position: -45
Score: 6.58196 Sequence: TTTTGTAAGCATTTACAAGA
Locus tag: LJ1266
Name: LJ1266 Funciton: Transketolase, N-terminal section (EC 2.2.1.1)
Locus tag: LJ1267
Name: LJ1267 Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
Locus tag: LJ1268
Name: LJ1268 Funciton: Predicted pentose kinase |
||||
LJ1266-LJ1267-LJ1268 | -45 | 6.6 | TTTTGTAAGCATTTACAAGA | LJ1266 |