Orthologous regulated operons containing LSEI_0368 gene
| Regulog: | LSEI_0368 - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactobacillus casei ATCC 334 | ||||
|
Position: -169
Score: 6.72384 Sequence: TTGCGGTAACGTTTACGCAA
Position: -71
Score: 6.4612 Sequence: TTGTGTAAACGTTTTCGCAT
Locus tag: LSEI_0368
Name: LSEI_0368 Funciton: Predicted sugar utilization transcriptional regulator, LacI family |
||||
| LSEI_0368 | -169 | 6.7 | TTGCGGTAACGTTTACGCAA | LSEI_0368 |
| -71 | 6.5 | TTGTGTAAACGTTTTCGCAT | ||
| Lactobacillus rhamnosus GG | ||||
|
Position: -180
Score: 6.72384 Sequence: TTGCGGTAACGTTTACGCAA
Position: -82
Score: 6.4612 Sequence: TTGTGTAAACGTTTTCGCAC
Locus tag: LGG_00419
Name: LSEI_0368 Funciton: Predicted sugar utilization transcriptional regulator, LacI family |
||||
| LSEI_0368 | -180 | 6.7 | TTGCGGTAACGTTTACGCAA | LGG_00419 |
| -82 | 6.5 | TTGTGTAAACGTTTTCGCAC | ||