Orthologous regulated operons containing galM gene
| Regulog: | MdxR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | activator |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||||
|
Position: -203
Score: 6.30368 Sequence: TAATGTTATCGTTAACATTG
Locus tag: LEUM_0994
Name: malT Funciton: Predicted maltose/maltodextrin permease
Locus tag: LEUM_0995
Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8)
Locus tag: LEUM_0996
Name: galM Funciton: Aldose 1-epimerase
Locus tag: LEUM_0997
Name: pgcM Funciton: Beta-phosphoglucomutase (EC 5.4.2.6) |
||||
| malT-malK-galM-pgcM | -203 | 6.3 | TAATGTTATCGTTAACATTG | LEUM_0994 |