Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nigA gene

Properties
Regulog: NigR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Nigerose utilization
Effector: Nigerose-6-phosphate
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus johnsonii NCC 533
Position: -101
Score: 6.85964
Sequence: AACTTAAAACGTTTCAAGTT
Locus tag: LJ0739
Name: nigB
Funciton: Nigerose -specific PTS system, EIIB component
Locus tag: LJ0740
Name: nigC
Funciton: Nigerose-specific PTS system, EIIC component
Locus tag: LJ0741
Name: nigD
Funciton: Nigerose-specific PTS system, EIID component
Locus tag: LJ0742
Name: nigA
Funciton: Nigerose-specific PTS system, EIIA component
Locus tag: LJ0743
Name: ogl
Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
Locus tag: LJ0744
Name: nigR
Funciton: Nigerose utilization regulator, LacI family
nigB-nigC-nigD-nigA-ogl-nigR -101 6.9 AACTTAAAACGTTTCAAGTT LJ0739
Lactobacillus salivarius subsp. salivarius UCC118
Position: -86
Score: 6.9577
Sequence: AACTTGAAACGTTTAAAGTT
Locus tag: LSL_1716
Name: nigB
Funciton: Nigerose -specific PTS system, EIIB component
Locus tag: LSL_1715
Name: nigC
Funciton: Nigerose-specific PTS system, EIIC component
Locus tag: LSL_1714
Name: nigD
Funciton: Nigerose-specific PTS system, EIID component
Locus tag: LSL_1713
Name: nigA
Funciton: Nigerose-specific PTS system, EIIA component
Locus tag: LSL_1712
Name: ogl
Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
Locus tag: LSL_1711
Name: nigR
Funciton: Nigerose utilization regulator, LacI family
nigB-nigC-nigD-nigA-ogl-nigR -86 7 AACTTGAAACGTTTAAAGTT LSL_1716