Orthologous regulated operons containing malC gene
| Regulog: | MalR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactobacillus plantarum WCFS1 | ||||
|
Position: -86
Score: 6.03066 Sequence: TTACGAAAACGCTTGCGAAA
Position: -74
Score: 4.9198 Sequence: TTGCGAAAGCGTTTGCACAG
Locus tag: lp_0175
Name: malX Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: lp_0176
Name: malC Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: lp_0177
Name: malD Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: lp_0178
Name: malA Funciton: Maltodextrose utilization protein MalA |
||||
| malX-malC-malD-malA | -86 | 6 | TTACGAAAACGCTTGCGAAA | lp_0175 |
| -74 | 4.9 | TTGCGAAAGCGTTTGCACAG | ||