Orthologous regulated operons containing malX gene

Properties
Regulog:	MalR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes

Built upon 11 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus plantarum WCFS1
Position: -86 Score: 6.03066 Sequence: TTACGAAAACGCTTGCGAAA Position: -74 Score: 4.9198 Sequence: TTGCGAAAGCGTTTGCACAG Locus tag: lp_0175 Name: malX Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: lp_0176 Name: malC Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: lp_0177 Name: malD Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: lp_0178 Name: malA Funciton: Maltodextrose utilization protein MalA
malX-malC-malD-malA	-86	6	TTACGAAAACGCTTGCGAAA	lp_0175
	-74	4.9	TTGCGAAAGCGTTTGCACAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --