Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing malC gene

Properties
Regulog: MalR2 - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -151
Score: 7.00512
Sequence: CAACTTAAACGTTTAAATTA
Locus tag: SDEG_1305
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SDEG_1304
Name: amyB
Funciton: Neopullulanase (EC 3.2.1.135)
Locus tag: SDEG_1303
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SDEG_1302
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SDEG_1301
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: SDEG_1300
Name: malA
Funciton: Maltodextrose utilization protein MalA
malX-amyB-malC-malC-malD-malA -151 7 CAACTTAAACGTTTAAATTA SDEG_1305
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -163
Score: 7.56855
Sequence: TAACTTAAACGTTTAAGTTA
Locus tag: Sez_1266
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: Sez_1265
Name: amyB
Funciton: Neopullulanase (EC 3.2.1.135)
Locus tag: Sez_1264
Name: amyA
Funciton: Cyclodextrin glucanotransferase( EC:2.4.1.19 )
Locus tag: Sez_1263
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
malX-amyB-amyA-malC -163 7.6 TAACTTAAACGTTTAAGTTA Sez_1266
Streptococcus pyogenes M1 GAS
Position: -141
Score: 7.29974
Sequence: TAACTTAAACGTTTAAGTTT
Locus tag: SPy1306
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SPy1304
Name: amyB
Funciton: Neopullulanase (EC 3.2.1.135)
Locus tag: SPy1302
Name: amyA
Funciton: Cyclodextrin glucanotransferase( EC:2.4.1.19 )
Locus tag: SPy1301
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SPy1299
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: SPy1298
Name: malA
Funciton: Maltodextrose utilization protein MalA
malX-amyB-amyA-malC-malD-malA -141 7.3 TAACTTAAACGTTTAAGTTT SPy1306