Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing LACR_0363 gene

Properties
Regulog: CmbR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: repressor (activator)
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine
Phylum: Firmicutes
Built upon 104 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -476
Score: 4.35449
Sequence: TTTATAAATTAAACTTAAAAA
Locus tag: LACR_0360
Name: plpA
Funciton: Methionine ABC transporter, substrate-binding protein
Locus tag: LACR_0361
Name: plpB
Funciton: Methionine ABC transporter, substrate-binding protein
Locus tag: LACR_0362
Name: plpC
Funciton: Methionine ABC transporter, substrate-binding protein
Locus tag: LACR_0363
Name: LACR_0363
Funciton: Predicted reductase
Locus tag: LACR_0364
Name: plpD
Funciton: Methionine ABC transporter, substrate-binding protein
Locus tag: LACR_0365
Name: metP
Funciton: Methionine ABC transporter, permease protein
Locus tag: LACR_0366
Name: metN
Funciton: Methionine ABC transporter, ATP-binding protein
plpA-plpB-plpC-LACR_0363-plpD-metP-metN -476 4.4 TTTATAAATTAAACTTAAAAA LACR_0360
© 2009-2020 RegPrecise