Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SSA_2103 gene

Properties
Regulog: CmbR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: repressor (activator)
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine
Phylum: Firmicutes
Built upon 104 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus sanguinis SK36
Position: -194
Score: 5.25904
Sequence: TTGATAAAAATTACCTATCTC
Position: -59
Score: 5.0691
Sequence: TTGATAAATATTTTTAATCAG
Locus tag: SSA_2105
Name: tcyD
Funciton: Predicted uroporphyrinogen-III decarboxylase
Locus tag: SSA_2103
Name: SSA_2103
Funciton: Hypothetical protein
Locus tag: SSA_2102
Name: tcyD
Funciton: Predicted uroporphyrinogen-III decarboxylase
Locus tag: SSA_2101
Name: tcyE
Funciton: Predicted cysteine ABC transporter, substrate-binding protein
Locus tag: SSA_2099
Name: tcyF
Funciton: Predicted cysteine ABC transporter, permease protein 1
Locus tag: SSA_2098
Name: tcyG
Funciton: Predicted cysteine ABC transporter, permease protein 2
Locus tag: SSA_2097
Name: tcyH
Funciton: Predicted cysteine ABC transporter, ATP-binding protein
tcyD-SSA_2103-tcyD-tcyE-tcyF-tcyG-tcyH -194 5.3 TTGATAAAAATTACCTATCTC SSA_2105
-59 5.1 TTGATAAATATTTTTAATCAG