Orthologous regulated operons containing tcyH gene

Properties
Regulog:	CmbR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Phylum:	Firmicutes

Built upon 104 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptococcus gallolyticus UCN34
Position: -104 Score: 4.90252 Sequence: GCTATAAGCAAATCTTATGGC Locus tag: GALLO_1275 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: GALLO_1274 Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein Locus tag: GALLO_1273 Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1 Locus tag: GALLO_1272 Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2 Locus tag: GALLO_1271 Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein
tcyD-tcyE-tcyF-tcyG-tcyH	-104	4.9	GCTATAAGCAAATCTTATGGC	GALLO_1275
Streptococcus mutans UA159
Position: -168 Score: 4.98933 Sequence: GTGATAACTTTTTCTTATGGC Position: -103 Score: 5.30886 Sequence: GTCATAAATAAAATTTATAGC Locus tag: SMU.932 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: SMU.933 Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein Locus tag: SMU.934 Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1 Locus tag: SMU.935 Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2 Locus tag: SMU.936 Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein
tcyD-tcyE-tcyF-tcyG-tcyH	-168	5	GTGATAACTTTTTCTTATGGC	SMU.932
	-103	5.3	GTCATAAATAAAATTTATAGC
Streptococcus sanguinis SK36
Position: -194 Score: 5.25904 Sequence: TTGATAAAAATTACCTATCTC Position: -59 Score: 5.0691 Sequence: TTGATAAATATTTTTAATCAG Locus tag: SSA_2105 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: SSA_2103 Name: SSA_2103 Funciton: Hypothetical protein Locus tag: SSA_2102 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: SSA_2101 Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein Locus tag: SSA_2099 Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1 Locus tag: SSA_2098 Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2 Locus tag: SSA_2097 Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein
tcyD-SSA_2103-tcyD-tcyE-tcyF-tcyG-tcyH	-194	5.3	TTGATAAAAATTACCTATCTC	SSA_2105
	-59	5.1	TTGATAAATATTTTTAATCAG