Orthologous regulated operons containing tcyE gene
Regulog: | CmbR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LysR |
Regulation mode: | repressor (activator) |
Biological process: | Cysteine metabolism |
Effector: | O-acetyl-L-serine |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptococcus gallolyticus UCN34 | ||||
Position: -104
Score: 4.90252 Sequence: GCTATAAGCAAATCTTATGGC
Locus tag: GALLO_1275
Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase
Locus tag: GALLO_1274
Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein
Locus tag: GALLO_1273
Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1
Locus tag: GALLO_1272
Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2
Locus tag: GALLO_1271
Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein |
||||
tcyD-tcyE-tcyF-tcyG-tcyH | -104 | 4.9 | GCTATAAGCAAATCTTATGGC | GALLO_1275 |
Streptococcus mutans UA159 | ||||
Position: -168
Score: 4.98933 Sequence: GTGATAACTTTTTCTTATGGC
Position: -103
Score: 5.30886 Sequence: GTCATAAATAAAATTTATAGC
Locus tag: SMU.932
Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase
Locus tag: SMU.933
Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein
Locus tag: SMU.934
Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1
Locus tag: SMU.935
Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2
Locus tag: SMU.936
Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein |
||||
tcyD-tcyE-tcyF-tcyG-tcyH | -168 | 5 | GTGATAACTTTTTCTTATGGC | SMU.932 |
-103 | 5.3 | GTCATAAATAAAATTTATAGC | ||
Streptococcus sanguinis SK36 | ||||
Position: -194
Score: 5.25904 Sequence: TTGATAAAAATTACCTATCTC
Position: -59
Score: 5.0691 Sequence: TTGATAAATATTTTTAATCAG
Locus tag: SSA_2105
Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase
Locus tag: SSA_2103
Name: SSA_2103 Funciton: Hypothetical protein
Locus tag: SSA_2102
Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase
Locus tag: SSA_2101
Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein
Locus tag: SSA_2099
Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1
Locus tag: SSA_2098
Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2
Locus tag: SSA_2097
Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein |
||||
tcyD-SSA_2103-tcyD-tcyE-tcyF-tcyG-tcyH | -194 | 5.3 | TTGATAAAAATTACCTATCTC | SSA_2105 |
-59 | 5.1 | TTGATAAATATTTTTAATCAG |