Orthologous regulated operons containing COG1739 gene
| Regulog: | CmbR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | repressor (activator) |
| Biological process: | Cysteine metabolism |
| Effector: | O-acetyl-L-serine |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptococcus thermophilus CNRZ1066 | ||||
|
Position: -16
Score: 5.17835 Sequence: ATGATAAAATTTTTTTATGGA
Locus tag: str0367
Name: COG1739 Funciton: Conserved hypothetical protein
Locus tag: str0366
Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47) |
||||
| COG1739-cysK | -16 | 5.2 | ATGATAAAATTTTTTTATGGA | str0367 |