Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing COG1739 gene

Properties
Regulog: CmbR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: repressor (activator)
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine
Phylum: Firmicutes
Built upon 104 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus thermophilus CNRZ1066
Position: -16
Score: 5.17835
Sequence: ATGATAAAATTTTTTTATGGA
Locus tag: str0367
Name: COG1739
Funciton: Conserved hypothetical protein
Locus tag: str0366
Name: cysK
Funciton: Cysteine synthase (EC 2.5.1.47)
COG1739-cysK -16 5.2 ATGATAAAATTTTTTTATGGA str0367
© 2009-2020 RegPrecise