Orthologous regulated operons containing abcP gene

Properties
Regulog:	Rcas_3562 - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Alpha-galactosides utilization
Effector:
Phylum:	Chloroflexi

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Roseiflexus castenholzii DSM 13941
Position: -44 Score: 7.4345 Sequence: TGTCTTATATCCTATGCCATAGGACA Locus tag: Rcas_3562 Name: Rcas_3562 Funciton: Transcriptional regulator, GntR family Locus tag: Rcas_3563 Name: galZ Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: Rcas_3564 Name: abcP Funciton: sugar ABC transporter, permease protein Locus tag: Rcas_3565 Name: abcT Funciton: sugar ABC transporter, permease 2 Locus tag: Rcas_3566 Name: abcB Funciton: sugar ABC transport system, sugar-binding protein Locus tag: Rcas_3567 Name: galY Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: Rcas_3568 Name: Rcas_3568 Funciton: hypothetical protein Locus tag: Rcas_3569 Name: Rcas_3569 Funciton: Putative oxidoreductase
Rcas_3562-galZ-abcP-abcT-abcB-galY-Rcas_3568-Rcas_3569	-44	7.4	TGTCTTATATCCTATGCCATAGGACA	Rcas_3562
Roseiflexus sp. RS-1
Position: -47 Score: 7.09512 Sequence: TGTCCTGCATCCTATGCAATAAGACA Locus tag: RoseRS_1355 Name: Rcas_3562 Funciton: Transcriptional regulator, GntR family Locus tag: RoseRS_1356 Name: galZ Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: RoseRS_1357 Name: abcP Funciton: sugar ABC transporter, permease protein Locus tag: RoseRS_1358 Name: abcT Funciton: sugar ABC transporter, permease 2 Locus tag: RoseRS_1359 Name: abcB Funciton: sugar ABC transport system, sugar-binding protein Locus tag: RoseRS_1360 Name: galY Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: RoseRS_1361 Name: Rcas_3568 Funciton: hypothetical protein Locus tag: RoseRS_1362 Name: Rcas_3569 Funciton: Putative oxidoreductase
Rcas_3562-galZ-abcP-abcT-abcB-galY-Rcas_3568-Rcas_3569	-47	7.1	TGTCCTGCATCCTATGCAATAAGACA	RoseRS_1355