Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing galZ gene

Properties
Regulog: Rcas_3562 - Chloroflexia
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Alpha-galactosides utilization
Effector:
Phylum: Chloroflexi
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Roseiflexus castenholzii DSM 13941
Position: -44
Score: 7.4345
Sequence: TGTCTTATATCCTATGCCATAGGACA
Locus tag: Rcas_3562
Name: Rcas_3562
Funciton: Transcriptional regulator, GntR family
Locus tag: Rcas_3563
Name: galZ
Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: Rcas_3564
Name: abcP
Funciton: sugar ABC transporter, permease protein
Locus tag: Rcas_3565
Name: abcT
Funciton: sugar ABC transporter, permease 2
Locus tag: Rcas_3566
Name: abcB
Funciton: sugar ABC transport system, sugar-binding protein
Locus tag: Rcas_3567
Name: galY
Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: Rcas_3568
Name: Rcas_3568
Funciton: hypothetical protein
Locus tag: Rcas_3569
Name: Rcas_3569
Funciton: Putative oxidoreductase
Rcas_3562-galZ-abcP-abcT-abcB-galY-Rcas_3568-Rcas_3569 -44 7.4 TGTCTTATATCCTATGCCATAGGACA Rcas_3562
Roseiflexus sp. RS-1
Position: -47
Score: 7.09512
Sequence: TGTCCTGCATCCTATGCAATAAGACA
Locus tag: RoseRS_1355
Name: Rcas_3562
Funciton: Transcriptional regulator, GntR family
Locus tag: RoseRS_1356
Name: galZ
Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: RoseRS_1357
Name: abcP
Funciton: sugar ABC transporter, permease protein
Locus tag: RoseRS_1358
Name: abcT
Funciton: sugar ABC transporter, permease 2
Locus tag: RoseRS_1359
Name: abcB
Funciton: sugar ABC transport system, sugar-binding protein
Locus tag: RoseRS_1360
Name: galY
Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: RoseRS_1361
Name: Rcas_3568
Funciton: hypothetical protein
Locus tag: RoseRS_1362
Name: Rcas_3569
Funciton: Putative oxidoreductase
Rcas_3562-galZ-abcP-abcT-abcB-galY-Rcas_3568-Rcas_3569 -47 7.1 TGTCCTGCATCCTATGCAATAAGACA RoseRS_1355