Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Rcas_3900 gene

Properties
Regulog: Zur2 - Chloroflexia
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Chloroflexi
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Roseiflexus castenholzii DSM 13941
Position: -157
Score: 5.61081
Sequence: CAACTGATAGATAAGATCATTTG
Locus tag: Rcas_3900
Name: Rcas_3900
Funciton: Zinc finger domain, similar to cold shock proteins
Rcas_3900 -157 5.6 CAACTGATAGATAAGATCATTTG Rcas_3900
Roseiflexus sp. RS-1
Position: -159
Score: 5.46124
Sequence: CAAATGATAGACGAGATCATTTG
Locus tag: RoseRS_0598
Name: Rcas_3900
Funciton: Zinc finger domain, similar to cold shock proteins
Rcas_3900 -159 5.5 CAAATGATAGACGAGATCATTTG RoseRS_0598
© 2009-2020 RegPrecise