Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing yciC2 gene

Properties
Regulog: Zur - Chloroflexia
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Chloroflexi
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -52
Score: 5.47155
Sequence: AAATGATATATTATCTCAATA
Locus tag: Cagg_0322
Name: fmdB
Funciton: putative regulatory protein, FmdB family
Locus tag: Cagg_0321
Name: yciC2
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
fmdB-yciC2 -52 5.5 AAATGATATATTATCTCAATA Cagg_0322
Herpetosiphon aurantiacus ATCC 23779
Position: -286
Score: 6.49777
Sequence: TAATGATATATTGTATCAATA
Locus tag: Haur_2074
Name: yciC2
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: Haur_2073
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
yciC2-zur -286 6.5 TAATGATATATTGTATCAATA Haur_2074