Orthologous regulated operons containing tcyF gene
| Regulog: | HomR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | activator |
| Biological process: | Methionine metabolism; Cysteine metabolism |
| Effector: | O-acetyl-L-serine |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptococcus gallolyticus UCN34 | ||||
|
Position: -104
Score: 5.58477 Sequence: GCTATAAGCAAATCTTATGGC
Locus tag: GALLO_1275
Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase
Locus tag: GALLO_1274
Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein
Locus tag: GALLO_1273
Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1
Locus tag: GALLO_1272
Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2
Locus tag: GALLO_1271
Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein |
||||
| tcyD-tcyE-tcyF-tcyG-tcyH | -104 | 5.6 | GCTATAAGCAAATCTTATGGC | GALLO_1275 |
| Streptococcus mutans UA159 | ||||
|
Position: -168
Score: 5.20554 Sequence: GTGATAACTTTTTCTTATGGC
Position: -103
Score: 6.06284 Sequence: GTCATAAATAAAATTTATAGC
Locus tag: SMU.932
Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase
Locus tag: SMU.933
Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein
Locus tag: SMU.934
Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1
Locus tag: SMU.935
Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2
Locus tag: SMU.936
Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein |
||||
| tcyD-tcyE-tcyF-tcyG-tcyH | -168 | 5.2 | GTGATAACTTTTTCTTATGGC | SMU.932 |
| -103 | 6.1 | GTCATAAATAAAATTTATAGC | ||