Orthologous regulated operons containing tcyF gene

Properties
Regulog:	HomR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Methionine metabolism; Cysteine metabolism
Effector:	O-acetyl-L-serine
Phylum:	Firmicutes

Built upon 24 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptococcus gallolyticus UCN34
Position: -104 Score: 5.58477 Sequence: GCTATAAGCAAATCTTATGGC Locus tag: GALLO_1275 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: GALLO_1274 Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein Locus tag: GALLO_1273 Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1 Locus tag: GALLO_1272 Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2 Locus tag: GALLO_1271 Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein
tcyD-tcyE-tcyF-tcyG-tcyH	-104	5.6	GCTATAAGCAAATCTTATGGC	GALLO_1275
Streptococcus mutans UA159
Position: -168 Score: 5.20554 Sequence: GTGATAACTTTTTCTTATGGC Position: -103 Score: 6.06284 Sequence: GTCATAAATAAAATTTATAGC Locus tag: SMU.932 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: SMU.933 Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein Locus tag: SMU.934 Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1 Locus tag: SMU.935 Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2 Locus tag: SMU.936 Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein
tcyD-tcyE-tcyF-tcyG-tcyH	-168	5.2	GTGATAACTTTTTCTTATGGC	SMU.932
	-103	6.1	GTCATAAATAAAATTTATAGC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --