Orthologous regulated operons containing metB1 gene
| Regulog: | CmbR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | repressor (activator) |
| Biological process: | Cysteine metabolism |
| Effector: | O-acetyl-L-serine |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactococcus lactis subsp. lactis Il1403 | ||||
|
Position: -132
Score: 4.33984 Sequence: GCCATAGGCAAGTTTTATTAT
Locus tag: L0101
Name: metA Funciton: Homoserine O-succinyltransferase (EC 2.3.1.46)
Locus tag: L0102
Name: metB1 Funciton: Cystathionine gamma-synthase (EC 2.5.1.48) |
||||
| metA-metB1 | -132 | 4.3 | GCCATAGGCAAGTTTTATTAT | L0101 |