Orthologous regulated operons containing str1579 gene

Properties
Regulog:	CmbR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Phylum:	Firmicutes

Built upon 104 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptococcus gallolyticus UCN34
Position: -96 Score: 5.2609 Sequence: GCTATAAAAATTATTTATGGC Locus tag: GALLO_1237 Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1 Locus tag: GALLO_1236 Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2 Locus tag: GALLO_1235 Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein Locus tag: GALLO_1234 Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein
str1582-str1581-str1580-str1579	-96	5.3	GCTATAAAAATTATTTATGGC	GALLO_1237
Streptococcus gordonii str. Challis substr. CH1
Position: -139 Score: 5.1766 Sequence: CTTATAAATTTTTTCTATCAG Position: -117 Score: 4.85418 Sequence: CCGATAAAATATACATATTAT Locus tag: SGO_0985 Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1 Locus tag: SGO_0984 Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2 Locus tag: SGO_0983 Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein Locus tag: SGO_0982 Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein
str1582-str1581-str1580-str1579	-139	5.2	CTTATAAATTTTTTCTATCAG	SGO_0985
	-117	4.9	CCGATAAAATATACATATTAT
Streptococcus mitis B6
Position: -102 Score: 5.50008 Sequence: ATGATAAAAAATCCTTATAAC Position: -80 Score: 4.43512 Sequence: GCAATAAAAAATAGATATTAT Locus tag: smi_1436 Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1 Locus tag: smi_1437 Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2 Locus tag: smi_1438 Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein Locus tag: smi_1439 Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein
str1582-str1581-str1580-str1579	-102	5.5	ATGATAAAAAATCCTTATAAC	smi_1436
	-80	4.4	GCAATAAAAAATAGATATTAT
Streptococcus thermophilus CNRZ1066
Position: -237 Score: 4.84379 Sequence: GTTATATCTTTTCTTTATCAC Position: -215 Score: 5.17228 Sequence: TTGATAAAAAATACATATTAT Locus tag: str1582 Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1 Locus tag: str1581 Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2 Locus tag: str1580 Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein Locus tag: str1579 Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein
str1582-str1581-str1580-str1579	-237	4.8	GTTATATCTTTTCTTTATCAC	str1582
	-215	5.2	TTGATAAAAAATACATATTAT