Orthologous regulated operons containing str1581 gene
Regulog: | CmbR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LysR |
Regulation mode: | repressor (activator) |
Biological process: | Cysteine metabolism |
Effector: | O-acetyl-L-serine |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptococcus gallolyticus UCN34 | ||||
Position: -96
Score: 5.2609 Sequence: GCTATAAAAATTATTTATGGC
Locus tag: GALLO_1237
Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1
Locus tag: GALLO_1236
Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2
Locus tag: GALLO_1235
Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein
Locus tag: GALLO_1234
Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein |
||||
str1582-str1581-str1580-str1579 | -96 | 5.3 | GCTATAAAAATTATTTATGGC | GALLO_1237 |
Streptococcus gordonii str. Challis substr. CH1 | ||||
Position: -139
Score: 5.1766 Sequence: CTTATAAATTTTTTCTATCAG
Position: -117
Score: 4.85418 Sequence: CCGATAAAATATACATATTAT
Locus tag: SGO_0985
Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1
Locus tag: SGO_0984
Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2
Locus tag: SGO_0983
Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein
Locus tag: SGO_0982
Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein |
||||
str1582-str1581-str1580-str1579 | -139 | 5.2 | CTTATAAATTTTTTCTATCAG | SGO_0985 |
-117 | 4.9 | CCGATAAAATATACATATTAT | ||
Streptococcus mitis B6 | ||||
Position: -102
Score: 5.50008 Sequence: ATGATAAAAAATCCTTATAAC
Position: -80
Score: 4.43512 Sequence: GCAATAAAAAATAGATATTAT
Locus tag: smi_1436
Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1
Locus tag: smi_1437
Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2
Locus tag: smi_1438
Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein
Locus tag: smi_1439
Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein |
||||
str1582-str1581-str1580-str1579 | -102 | 5.5 | ATGATAAAAAATCCTTATAAC | smi_1436 |
-80 | 4.4 | GCAATAAAAAATAGATATTAT | ||
Streptococcus pneumoniae TIGR4 | ||||
Position: -140
Score: 4.43512 Sequence: GCAATAAAAAATAGATATTAT
Locus tag: SP_0711
Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1
Locus tag: SP_0710
Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2
Locus tag: SP_0709
Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein |
||||
str1582-str1581-str1580 | -140 | 4.4 | GCAATAAAAAATAGATATTAT | SP_0711 |
Streptococcus thermophilus CNRZ1066 | ||||
Position: -237
Score: 4.84379 Sequence: GTTATATCTTTTCTTTATCAC
Position: -215
Score: 5.17228 Sequence: TTGATAAAAAATACATATTAT
Locus tag: str1582
Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1
Locus tag: str1581
Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2
Locus tag: str1580
Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein
Locus tag: str1579
Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein |
||||
str1582-str1581-str1580-str1579 | -237 | 4.8 | GTTATATCTTTTCTTTATCAC | str1582 |
-215 | 5.2 | TTGATAAAAAATACATATTAT |