Orthologous regulated operons containing treR gene
| Regulog: | TreR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose-6-phosphate |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||||
|
Position: -102
Score: 5.99604 Sequence: CAAATTTGTCTACAAGTTGT
Locus tag: SDEG_2070
Name: treR Funciton: Trehalose utilization transcriptional regulator TreR, GntR family |
||||
| treR | -102 | 6 | CAAATTTGTCTACAAGTTGT | SDEG_2070 |
| Streptococcus gallolyticus UCN34 | ||||
|
Position: -116
Score: 5.62441 Sequence: CCATTTTGTCTGCAAGTTGT
Locus tag: GALLO_2176
Name: treR Funciton: Trehalose utilization transcriptional regulator TreR, GntR family |
||||
| treR | -116 | 5.6 | CCATTTTGTCTGCAAGTTGT | GALLO_2176 |
| Streptococcus gordonii str. Challis substr. CH1 | ||||
|
Position: -93
Score: 5.40973 Sequence: CAAACGTGTATGCAAGATGT
Locus tag: SGO_1654
Name: treR Funciton: Trehalose utilization transcriptional regulator TreR, GntR family |
||||
| treR | -93 | 5.4 | CAAACGTGTATGCAAGATGT | SGO_1654 |
| Streptococcus mutans UA159 | ||||
|
Position: -99
Score: 5.62683 Sequence: CAAATTTGTTGGCAAGTTGT
Locus tag: SMU.2040
Name: treR Funciton: Trehalose utilization transcriptional regulator TreR, GntR family |
||||
| treR | -99 | 5.6 | CAAATTTGTTGGCAAGTTGT | SMU.2040 |
| Streptococcus pneumoniae TIGR4 | ||||
|
Position: -124
Score: 5.80387 Sequence: CAAACTTGTCTGCAACTTGT
Locus tag: SP_1885
Name: treR Funciton: Trehalose utilization transcriptional regulator TreR, GntR family |
||||
| treR | -124 | 5.8 | CAAACTTGTCTGCAACTTGT | SP_1885 |
| Streptococcus pyogenes M1 GAS | ||||
|
Position: -102
Score: 5.99604 Sequence: CAAATTTGTCTACAAGTTGT
Locus tag: SPy2099
Name: treR Funciton: Trehalose utilization transcriptional regulator TreR, GntR family |
||||
| treR | -102 | 6 | CAAATTTGTCTACAAGTTGT | SPy2099 |
| Streptococcus sanguinis SK36 | ||||
|
Position: -91
Score: 5.51578 Sequence: CAAAGATGTATGCAAGTTGT
Locus tag: SSA_1753
Name: treR Funciton: Trehalose utilization transcriptional regulator TreR, GntR family |
||||
| treR | -91 | 5.5 | CAAAGATGTATGCAAGTTGT | SSA_1753 |
| Streptococcus uberis 0140J | ||||
|
Position: -104
Score: 5.91518 Sequence: CAAATTTGTAGGCAAGTTGT
Locus tag: SUB1764
Name: treR Funciton: Trehalose utilization transcriptional regulator TreR, GntR family |
||||
| treR | -104 | 5.9 | CAAATTTGTAGGCAAGTTGT | SUB1764 |