Orthologous regulated operons containing rbsB gene
| Regulog: | RbsR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactobacillus casei ATCC 334 | ||||
|
Position: -45
Score: 6.73597 Sequence: TAAGTAAAACGTTTTACCTA
Locus tag: LSEI_0306
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: LSEI_0307
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: LSEI_0308
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: LSEI_0309
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: LSEI_0310
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsD-rbsA-rbsC-rbsB | -45 | 6.7 | TAAGTAAAACGTTTTACCTA | LSEI_0306 |