Orthologous regulated operons containing murR gene
Regulog: | MurR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | RpiR |
Regulation mode: | repressor |
Biological process: | N-acetylmuramate utilization |
Effector: | N-acetylmuramate-6-phosphate |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Lactococcus lactis subsp. cremoris SK11 | ||||
Position: -111
Score: 6.60059 Sequence: AAACGAAATAATATTTCTTAA
Position: -71
Score: 6.55814 Sequence: GCTTGAAATAATAATTCGTTT
Locus tag: LACR_1240
Name: murX Funciton: Predicted outer membrane protein
Locus tag: LACR_1241
Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: LACR_1242
Name: murP Funciton: MurNAc-specific PTS system, EIIBC component
Locus tag: LACR_1243
Name: murR Funciton: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family |
||||
murX-murQ-murP-murR | -111 | 6.6 | AAACGAAATAATATTTCTTAA | LACR_1240 |
-71 | 6.6 | GCTTGAAATAATAATTCGTTT | ||
Lactococcus lactis subsp. lactis Il1403 | ||||
Position: -112
Score: 6.36939 Sequence: CAATGAAATAATATTTCAAAA
Position: -71
Score: 6.78934 Sequence: ACTTGAAATAATAATTCTTTT
Locus tag: L143292
Name: murX Funciton: Predicted outer membrane protein
Locus tag: L144334
Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: L145238
Name: murP Funciton: MurNAc-specific PTS system, EIIBC component
Locus tag: L146642
Name: murP Funciton: MurNAc-specific PTS system, EIIBC component
Locus tag: L147291
Name: murR Funciton: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family |
||||
murX-murQ-murP-murP-murR | -112 | 6.4 | CAATGAAATAATATTTCAAAA | L143292 |
-71 | 6.8 | ACTTGAAATAATAATTCTTTT |