Orthologous regulated operons containing murX gene

Properties
Regulog:	MurR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:	repressor
Biological process:	N-acetylmuramate utilization
Effector:	N-acetylmuramate-6-phosphate
Phylum:	Firmicutes

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -111 Score: 6.60059 Sequence: AAACGAAATAATATTTCTTAA Position: -71 Score: 6.55814 Sequence: GCTTGAAATAATAATTCGTTT Locus tag: LACR_1240 Name: murX Funciton: Predicted outer membrane protein Locus tag: LACR_1241 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: LACR_1242 Name: murP Funciton: MurNAc-specific PTS system, EIIBC component Locus tag: LACR_1243 Name: murR Funciton: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family
murX-murQ-murP-murR	-111	6.6	AAACGAAATAATATTTCTTAA	LACR_1240
	-71	6.6	GCTTGAAATAATAATTCGTTT
Lactococcus lactis subsp. lactis Il1403
Position: -112 Score: 6.36939 Sequence: CAATGAAATAATATTTCAAAA Position: -71 Score: 6.78934 Sequence: ACTTGAAATAATAATTCTTTT Locus tag: L143292 Name: murX Funciton: Predicted outer membrane protein Locus tag: L144334 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: L145238 Name: murP Funciton: MurNAc-specific PTS system, EIIBC component Locus tag: L146642 Name: murP Funciton: MurNAc-specific PTS system, EIIBC component Locus tag: L147291 Name: murR Funciton: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family
murX-murQ-murP-murP-murR	-112	6.4	CAATGAAATAATATTTCAAAA	L143292
	-71	6.8	ACTTGAAATAATAATTCTTTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --