Orthologous regulated operons containing galM gene

Properties
Regulog:	MalR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes

Built upon 11 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus plantarum WCFS1
Position: -87 Score: 6.2622 Sequence: TCACGCAAACGCTTGCATAA Locus tag: lp_1729 Name: malT Funciton: Predicted maltose/maltodextrin permease Locus tag: lp_1730 Name: mapA Funciton: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64) Locus tag: lp_1731 Name: galM Funciton: Aldose 1-epimerase
malT-mapA-galM	-87	6.3	TCACGCAAACGCTTGCATAA	lp_1729
Lactobacillus salivarius subsp. salivarius UCC118
Position: -117 Score: 6.2622 Sequence: TATCGCAAACGGTTGCAAAA Locus tag: LSL_1282 Name: malT Funciton: Predicted maltose/maltodextrin permease Locus tag: LSL_1281 Name: galM Funciton: Aldose 1-epimerase Locus tag: LSL_1280 Name: mapA Funciton: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64) Locus tag: LSL_1279 Name: pgmB Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
malT-galM-mapA-pgmB	-117	6.3	TATCGCAAACGGTTGCAAAA	LSL_1282
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Position: -186 Score: 6.10746 Sequence: TTGTGCAAACGCTTCCATTA Locus tag: LEUM_0994 Name: malT Funciton: Predicted maltose/maltodextrin permease Locus tag: LEUM_0995 Name: mapA Funciton: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64) Locus tag: LEUM_0996 Name: galM Funciton: Aldose 1-epimerase Locus tag: LEUM_0997 Name: pgmB Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
malT-mapA-galM-pgmB	-186	6.1	TTGTGCAAACGCTTCCATTA	LEUM_0994

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --