Orthologous regulated operons containing cinD gene
| Regulog: | CopR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CopY |
| Regulation mode: | repressor |
| Biological process: | Copper homeostasis |
| Effector: | Copper ion, (Cu2+) |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||||
|
Position: -72
Score: 6.21831 Sequence: TAGTTTACAAGTGTAAATTT
Position: -45
Score: 5.59429 Sequence: AAGATTACAGATGTAAACAA
Locus tag: LACR_2184
Name: cinD Funciton: Copper-induced nitroreductase |
||||
| cinD | -72 | 6.2 | TAGTTTACAAGTGTAAATTT | LACR_2184 |
| -45 | 5.6 | AAGATTACAGATGTAAACAA | ||
| Lactococcus lactis subsp. lactis Il1403 | ||||
|
Position: -73
Score: 6.21831 Sequence: TAGTTTACAAGTGTAAATTT
Position: -46
Score: 5.64158 Sequence: AAGATTACATATGTAAACAA
Locus tag: L174788
Name: cinD Funciton: Copper-induced nitroreductase |
||||
| cinD | -73 | 6.2 | TAGTTTACAAGTGTAAATTT | L174788 |
| -46 | 5.6 | AAGATTACATATGTAAACAA | ||