Orthologous regulated operons containing znuB2 gene

Properties
Regulog:	Zur - Actinobacteria
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Actinobacteria

Built upon 69 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Brevibacterium linens BL2
Position: -25 Score: 4.70085 Sequence: TAACAATAATGGTTATCATCA Locus tag: BlinB01002692 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuB2	-25	4.7	TAACAATAATGGTTATCATCA	BlinB01002692
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Position: -40 Score: 4.43656 Sequence: AGTTGATAAGCATTCTCATTC Locus tag: CMM_0175 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: CMM_0176 Name: SCO00474 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: CMM_0177 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: CMM_0178 Name: SCO0472 Funciton: WD40/YVTN repeat-like-containing domain
znuB2-SCO00474-znuA2-SCO0472	-40	4.4	AGTTGATAAGCATTCTCATTC	CMM_0175
Rhodococcus sp. RHA1
Position: -31 Score: 5.10227 Sequence: TTACGACAATCATTATCGTTA Locus tag: RHA1_ro02546 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RHA1_ro02547 Name: SCO00474 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: RHA1_ro02548 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuB2-SCO00474-znuA2	-31	5.1	TTACGACAATCATTATCGTTA	RHA1_ro02546
Streptomyces coelicolor A3(2)
Position: -34 Score: 5.09772 Sequence: TGTTGAACATGATTTTCATTG Locus tag: SCO0475 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: SCO0474 Name: SCO00474 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: SCO0473 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: SCO0472 Name: SCO0472 Funciton: WD40/YVTN repeat-like-containing domain
znuB2-SCO00474-znuA2-SCO0472	-34	5.1	TGTTGAACATGATTTTCATTG	SCO0475