Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing znuB2 gene

Properties
Regulog: Zur - Actinobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidothermus cellulolyticus 11B
Position: -8
Score: 4.67891
Sequence: TACTTGCAATGATTTCCAACA
Locus tag: Acel_2086
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Acel_2087
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Acel_2088
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Acel_2089
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuA-znuC-znuB-znuB2 -8 4.7 TACTTGCAATGATTTCCAACA Acel_2086
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -43
Score: 5.41467
Sequence: TATTGAGAACGATTGTCAGCA
Locus tag: Blon_1757
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Blon_1758
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC-znuB2 -43 5.4 TATTGAGAACGATTGTCAGCA Blon_1757
© 2009-2020 RegPrecise