Orthologous regulated operons containing znuB2 gene
| Regulog: | Zur - Actinobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acidothermus cellulolyticus 11B | ||||
|
Position: -8
Score: 4.67891 Sequence: TACTTGCAATGATTTCCAACA
Locus tag: Acel_2086
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Acel_2087
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Acel_2088
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Acel_2089
Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB-znuB2 | -8 | 4.7 | TACTTGCAATGATTTCCAACA | Acel_2086 |
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||||
|
Position: -43
Score: 5.41467 Sequence: TATTGAGAACGATTGTCAGCA
Locus tag: Blon_1757
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Blon_1758
Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuC-znuB2 | -43 | 5.4 | TATTGAGAACGATTGTCAGCA | Blon_1757 |