Orthologous regulated operons containing znuC gene
| Regulog: | Zur - Actinobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acidothermus cellulolyticus 11B | ||||
|
Position: -8
Score: 4.67891 Sequence: TACTTGCAATGATTTCCAACA
Locus tag: Acel_2086
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Acel_2087
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Acel_2088
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Acel_2089
Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB-znuB2 | -8 | 4.7 | TACTTGCAATGATTTCCAACA | Acel_2086 |
| Actinosynnema mirum DSM 43827 | ||||
|
Position: -50
Score: 4.26476 Sequence: ACTCGACAACGGTTACCATTC
Locus tag: Amir_0352
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Amir_0353
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Amir_0354
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -50 | 4.3 | ACTCGACAACGGTTACCATTC | Amir_0352 |
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||||
|
Position: -43
Score: 5.41467 Sequence: TATTGAGAACGATTGTCAGCA
Locus tag: Blon_1757
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Blon_1758
Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuC-znuB2 | -43 | 5.4 | TATTGAGAACGATTGTCAGCA | Blon_1757 |
| Brachybacterium faecium DSM 4810 | ||||
|
Position: -8
Score: 4.80844 Sequence: TGGTGAGAATGATTGTCATGT
Locus tag: Bfae_17080
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Bfae_17090
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Bfae_17100
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Bfae_17110
Name: zur Funciton: Zinc uptake regulation protein Zur |
||||
| znuA-znuC-znuB-zur | -8 | 4.8 | TGGTGAGAATGATTGTCATGT | Bfae_17080 |
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||||
|
Position: -37
Score: 5.10264 Sequence: TAGTGAGACTGGTTATCAATA
Locus tag: CMM_2941
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: CMM_2940
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: CMM_2939
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: CMM_2938
Name: zur Funciton: Zinc uptake regulation protein Zur |
||||
| znuA-znuC-znuB-zur | -37 | 5.1 | TAGTGAGACTGGTTATCAATA | CMM_2941 |
| Janibacter sp. HTCC2649 | ||||
|
Position: -39
Score: 5.06336 Sequence: AGTTGACAATCATTCTCAACT
Position: -17
Score: 5.14615 Sequence: AGTTGAGAATGATTGTCATGA
Locus tag: JNB_04825
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: JNB_04830
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: JNB_04835
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: JNB_04840
Name: zur Funciton: Zinc uptake regulation protein Zur |
||||
| znuA-znuC-znuB-zur | -39 | 5.1 | AGTTGACAATCATTCTCAACT | JNB_04825 |
| -17 | 5.1 | AGTTGAGAATGATTGTCATGA | ||
| Kocuria rhizophila DC2201 | ||||
|
Position: -63
Score: 4.44609 Sequence: TGATGACACTGATTCTCATCG
Locus tag: KRH_09480
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: KRH_09490
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: KRH_09500
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -63 | 4.4 | TGATGACACTGATTCTCATCG | KRH_09480 |
| Kytococcus sedentarius DSM 20547 | ||||
|
Position: -17
Score: 4.15706 Sequence: ACCTGAGAATCATTGTCATGC
Locus tag: Ksed_11830
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Ksed_11820
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Ksed_11810
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Ksed_11800
Name: zur Funciton: Zinc uptake regulation protein Zur |
||||
| znuA-znuC-znuB-zur | -17 | 4.2 | ACCTGAGAATCATTGTCATGC | Ksed_11830 |
| Leifsonia xyli subsp. xyli str. CTCB07 | ||||
|
Position: -86
Score: 5.55494 Sequence: TTTTGACAATCATTATCAACA
Locus tag: Lxx25040
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Lxx25025
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Lxx25020
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Lxx25010
Name: zur Funciton: Zinc uptake regulation protein Zur |
||||
| znuA-znuC-znuB-zur | -86 | 5.6 | TTTTGACAATCATTATCAACA | Lxx25040 |
| Nocardioides sp. JS614 | ||||
|
Position: -30
Score: 4.6031 Sequence: GTTTGACAATCATTCTCAATC
Position: -8
Score: 4.32956 Sequence: GGCTGAGAATGATTCTCATGA
Locus tag: Noca_1937
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Noca_1936
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Noca_1935
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Noca_1934
Name: zur Funciton: Zinc uptake regulation protein Zur |
||||
| znuA-znuC-znuB-zur | -30 | 4.6 | GTTTGACAATCATTCTCAATC | Noca_1937 |
| -8 | 4.3 | GGCTGAGAATGATTCTCATGA | ||
| Propionibacterium acnes KPA171202 | ||||
|
Position: -46
Score: 4.66276 Sequence: ATACGACAATGGTTATCACTT
Locus tag: PPA0617
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: PPA0616
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: PPA0615
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -46 | 4.7 | ATACGACAATGGTTATCACTT | PPA0617 |
| Rhodococcus sp. RHA1 | ||||
|
Position: -55
Score: 4.82622 Sequence: CAACGGTAACGGTTTCCAATA
Locus tag: RHA1_ro04479
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: RHA1_ro04478
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: RHA1_ro04477
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -55 | 4.8 | CAACGGTAACGGTTTCCAATA | RHA1_ro04479 |
| Saccharomonospora viridis DSM 43017 | ||||
|
Position: -90
Score: 5.89675 Sequence: TATCGAAAATCATTTCCAATA
Locus tag: Svir_35300
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Svir_35290
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Svir_35280
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -90 | 5.9 | TATCGAAAATCATTTCCAATA | Svir_35300 |
| Saccharopolyspora erythraea NRRL 2338 | ||||
|
Position: -69
Score: 5.03586 Sequence: ACATGACAACGGTTTCCGTTA
Locus tag: SACE_0453
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SACE_0452
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SACE_0451
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -69 | 5 | ACATGACAACGGTTTCCGTTA | SACE_0453 |
| Streptomyces coelicolor A3(2) | ||||
|
Position: -39
Score: 5.22508 Sequence: TGTTGACAACGGTTTCCATAT
Position: -17
Score: 5.15991 Sequence: TGTTGAAAATGAGTGTCATGA
Locus tag: SCO2505
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SCO2506
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SCO2507
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SCO2508
Name: zur Funciton: Zinc uptake regulation protein Zur |
||||
| znuA-znuC-znuB-zur | -39 | 5.2 | TGTTGACAACGGTTTCCATAT | SCO2505 |
| -17 | 5.2 | TGTTGAAAATGAGTGTCATGA | ||