Orthologous regulated operons containing yciC4 gene
| Regulog: | Zur - Actinobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Brevibacterium linens BL2 | ||||
|
Position: -60
Score: 5.73295 Sequence: TAATGAAAAACGTTACCATTA
Locus tag: BlinB01002695
Name: yciC4 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
||||
| yciC4 | -60 | 5.7 | TAATGAAAAACGTTACCATTA | BlinB01002695 |