Orthologous regulated operons containing KRH_17290 gene
| Regulog: | Zur - Actinobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Kocuria rhizophila DC2201 | ||||
|
Position: -120
Score: 5.30713 Sequence: TAACGAGAACCGTTATCATTT
Locus tag: KRH_17300
Name: null Funciton: hypothetical protein
Locus tag: KRH_17290
Name: null Funciton: hypothetical protein
Locus tag: KRH_17280
Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
||||
| KRH_17300-KRH_17290-yciC2 | -120 | 5.3 | TAACGAGAACCGTTATCATTT | KRH_17300 |