Orthologous regulated operons containing DIP0440 gene
| Regulog: | Zur - Actinobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Actinosynnema mirum DSM 43827 | ||||
|
Position: -79
Score: 5.0856 Sequence: GATTGAAAACGGTTGTCGTTT
Locus tag: Amir_4768
Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Amir_4769
Name: null Funciton: hypothetical protein
Locus tag: Amir_4770
Name: DIP0440 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Amir_4771
Name: DIP0441 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| troA-Amir_4769-DIP0440-DIP0441 | -79 | 5.1 | GATTGAAAACGGTTGTCGTTT | Amir_4768 |
| Propionibacterium acnes KPA171202 | ||||
|
Position: -49
Score: 5.29179 Sequence: AATCGATAACCGTTCTCATTA
Locus tag: PPA1500
Name: sapD Funciton: Conserved hypothetical protein CHP03773, ABC transporter-like
Locus tag: PPA1501
Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: PPA1502
Name: DIP0439 Funciton: Surface-anchored repeat, actinobacteria
Locus tag: PPA1503
Name: DIP0440 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: PPA1504
Name: DIP0441 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| sapD-troA-DIP0439-DIP0440-DIP0441 | -49 | 5.3 | AATCGATAACCGTTCTCATTA | PPA1500 |