Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing DIP0440 gene

Properties
Regulog: Zur - Actinobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Actinosynnema mirum DSM 43827
Position: -79
Score: 5.0856
Sequence: GATTGAAAACGGTTGTCGTTT
Locus tag: Amir_4768
Name: troA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Amir_4769
Name: null
Funciton: hypothetical protein
Locus tag: Amir_4770
Name: DIP0440
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Amir_4771
Name: DIP0441
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
troA-Amir_4769-DIP0440-DIP0441 -79 5.1 GATTGAAAACGGTTGTCGTTT Amir_4768
Propionibacterium acnes KPA171202
Position: -49
Score: 5.29179
Sequence: AATCGATAACCGTTCTCATTA
Locus tag: PPA1500
Name: sapD
Funciton: Conserved hypothetical protein CHP03773, ABC transporter-like
Locus tag: PPA1501
Name: troA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: PPA1502
Name: DIP0439
Funciton: Surface-anchored repeat, actinobacteria
Locus tag: PPA1503
Name: DIP0440
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: PPA1504
Name: DIP0441
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
sapD-troA-DIP0439-DIP0440-DIP0441 -49 5.3 AATCGATAACCGTTCTCATTA PPA1500