Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Amir_4774 gene

Properties
Regulog: Zur - Actinobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Actinosynnema mirum DSM 43827
Position: -61
Score: 5.57305
Sequence: TATTGAAAATGATTGTCCTTT
Locus tag: Amir_4776
Name: sapD
Funciton: Conserved hypothetical protein CHP03773, ABC transporter-like
Locus tag: Amir_4775
Name: null
Funciton: hypothetical protein
Locus tag: Amir_4774
Name: Amir_4774
Funciton: protein of unknown function DUF916 cell surface putative
Locus tag: Amir_4773
Name: yciC3
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
sapD-Amir_4775-Amir_4774-yciC3 -61 5.6 TATTGAAAATGATTGTCCTTT Amir_4776
© 2009-2020 RegPrecise