Orthologous regulated operons containing Amir_3101 gene
| Regulog: | Zur - Actinobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Actinosynnema mirum DSM 43827 | ||||
|
Position: -61
Score: 5.57305 Sequence: TATTGAAAATGATTGTCCTTT
Locus tag: Amir_4776
Name: sapD Funciton: Conserved hypothetical protein CHP03773, ABC transporter-like
Locus tag: Amir_4775
Name: null Funciton: hypothetical protein
Locus tag: Amir_4774
Name: Amir_4774 Funciton: protein of unknown function DUF916 cell surface putative
Locus tag: Amir_4773
Name: yciC3 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
||||
| sapD-Amir_4775-Amir_4774-yciC3 | -61 | 5.6 | TATTGAAAATGATTGTCCTTT | Amir_4776 |