Orthologous regulated operons containing Arth_3253 gene
| Regulog: | Zur - Actinobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Arthrobacter sp. FB24 | ||||
|
Position: -2
Score: 5.18588 Sequence: AAATGAGAATGATTCTCATAT
Locus tag: Arth_3252
Name: null Funciton: hypothetical protein
Locus tag: Arth_3253
Name: null Funciton: hypothetical protein
Locus tag: Arth_3254
Name: rpmJ2 Funciton: 50S ribosomal protein L36 |
||||
| Arth_3252-Arth_3253-rpmJ2 | -2 | 5.2 | AAATGAGAATGATTCTCATAT | Arth_3252 |